MySQL 8.0.0 has a few new UUID functions! Read all about this here!
Sure, there are tools and script to help you fine tune your MySQL server but there’s nothing like using your brain.
Pythian has done a wonderful job of explaining what all those InnoDb-related variables in a series of articles…
Exposing Innodb Internals via System Variables:
Part 1, Memory
Exposing Innodb Internals via System Variables:
Part 2, I/O (structure and logs)
Exposing Innodb Internals via System Variables:
Part 3, I/O (Table data)
…
Ce mardi 6 septembre, un superbe meetup MySQL c’est déroulé à Paris dans les locaux d’ Executive MBA Epitech à Paris. Organisé et sponsorisé par Oracle MySQL et Openska. Un grand merci à tous les participants, aux organisateurs et au sponsor (Oracle). Merci également à Frédéric (EMEA MySQL Community Manager) et à Dimitri (MySQL Performance Architect). Vous pouvez récupérer les présentations sur […]
Oracle MySQL, Openska et Executive MBA Epitech ont le plaisir de vous inviter le mardi 6 septembre pour le premier meetup MySQL de la rentrée. Au programme: MySQL Group Replication & MySQL as a Document Store
What’s up?
As you can see, Freewill now supports 17 different selection policies. At this point, all of them are coded but only half of them have been tested.
The 11 available termination policies are coded, half of them tested.
So far, only 2 mutation policies are available. Both of them are coded and tested. I will probably need a few extras for TSP type of problems as well as numerically parametrized problems (e.g. De Jong functions with a domain for each variable). I’ll probably add 3-4 other ones specific to the problem that started all this adventure!
Only one immigration policy (no immigration!) is available and it will stay that way …
[Lire plus]Note: this article was originally posted in French here.
You! Yes! Yep, you! I’m talking to you my friend! You, the one that I help out in forums, on IRC, on mailing lists!
Each and every day, I answer questions related to MySQL, mostly about SQL queries or optimization problems. Whether it’s on dBForums, Stack Overflow, MySQL.com, developpez.net or on IRC (irc.freenode.net, channel #mysql), it’s always the same thing! If you want me to help you, make it easy for me!
So, here’s a quick guide explaining what you have to do if …
[Lire plus]This was originally posted in French here.
There’s no string function in MySQL (and many other databases!) to help you find the number of occurrences of a string within another string. For example, how many times does « abc » appear in « abcbcbabcbacbcabcababcabacb » ?
I was asked this question on IRC a long time ago. Some poor soul was trying to find a particular subsequence in a genomic string (for instance « TAT ») in the following sequence :
ATTGGTGGGCTCTACTAAGATATCAACGGGACTTCGGAGCGTGCCGCACTATTT
Obviously, you can use your favorite programming language and do this kind of search programmatically but is there a way to do it in SQL?
Luckily, the answer is yes! The solution is simple and looks like …
[Lire plus]What’s new?
After a major data loss (I haven’t given up on getting back all my data, mostly code repositories and databases!), I had to start all my pet projects from scratch. Luckily, it’s easier second time around as they say! And, lucky me, I store all my personal stuff on the web! So here’s a list of what’s coming up on this blog.
Ruzzle
Even though I had a decent working version of the genetic algorithm program to find the best ruzzle grid (original posts in French here, here and here), I wasn’t satisfied with the code. It slowly evolved from a bunch of code …
[Lire plus]Gestion des données pour les applications vitales
jeudi 19 mai 2016 à partir de 9H30
Microsoft France
39 Quai du Président Roosevelt
92130 Issy-les-Moulineaux
Comment réduire le délai de commercialisation des applications exigeant une haute disponibilité et une grande évolutivité ? Comment bien sécuriser vos données contre les menaces et attaques constantes ? Que faire pour optimiser les performances de la base de données dans le but d'améliorer l'expérience client ?
La base de données est au cœur de toute application critique. L'architecture et les capacités de la base de données déterminent la vitesse à laquelle vous pouvez commercialiser de nouvelles applications. La disponibilité, les performances et la sécurité de la base de données ont une influence sur la qualité des services rendus à l'entreprise et aux clients.
Rejoignez …
[Lire plus]MariaDB Roadshow - Paris : 19 Mai 2016
Comment réduire le délai de commercialisation d'applications exigeant une haute disponibilité et une grande évolutivité ? Comment bien sécuriser vos données contre les menaces et attaques constantes ? Que faire pour optimiser les performances de la base de données dans le but d'améliorer l'expérience client ?
La base de données est au cœur de toute application critique. L'architecture et les capacités de la base de données déterminent la vitesse à laquelle vous pouvez commercialiser de nouvelles applications. La disponibilité, les performances et la sécurité de la base de données ont une influence sur la qualité des services rendus à l'entreprise et aux clients.
…
[Lire plus]